Schützende Gene, genetische HIV Resistenz, CCR5 Test >

Immun gegen HIV und AIDS - gibt es das? Ja, HIV-Resistenz durch CCR5 Mutation!

Immun gegen AIDS und HIV - gibt es das? Ja, gerade in Westeuropa bei Traegern der CCR5 Delta 32/ Delta 32 Mutation (CCR5 Test, HIV Resistenztest, Immun gegen HIV)

Es gibt in Europa eine relativ grosse Gruppe von Menschen die genetisch widerstandsfähiger als andere Ethnien (z.B. Afrikaner oder Asiaten) bzw. in bestimmten Fällen sogar stark resistent bzw. immun gegen eine HIV Infektion sind.

Wird ein bestimmtes Gen mit der CCR5 Variante Delta 32/Delta 32 (CCR5 Polymorphismus) von beiden Eltern vererbt, (= homozygot) so kommt es nur in extrem seltenen Fällen zu einer HIV-1 Infektion, selbst bei andauernder Exposition mit HIV Viren vom Typ R5. Nur eine sogenannte X4 Virus-Variante kann dann bei solchen Individuen zu einer Infektion führen. Diese X4 Variante ist allerdings relativ selten, im Gegensatz zu der häufigen R5 Variante. Diese, für die Mutation CCR5 32 Delta homozygoten Menschen, sind von der Natur bevorteilt, indem sie faktisch immun gegen HIV und AIDS sind.

Bei Vererbung des mutierten Gens durch nur ein Elternteil (= heterozygot) ist zwar eine HIV Infektion mit beiden Virusvarianten R5 und X4 grundsätzlich möglich, jedoch ist immerhin die Progression zu AIDS noch stark eingeschränkt. Bis zu 17 % der Bevölkerung in manchen Regionen der westlichen Welt können diese relativ schützende Mutation zumindest auf einem Allel tragen.

Ein HIV Immunitätstest (CCR5 Test) dafür ist seit kurzem kommerziell über unsere Praxis verfügbar. Die Kosten für diesen Gentest betragen 199.- Euro. Der Test ist mit einem Abstrich von der Wangenschleimhaut ganz einfach vom Patienten selbst durchzuführen. Sie können entsprechendes Testmaterial zum Heimtest bei uns telefonisch oder per email anfordern und erhalten dieses dann umgehend mit der Post zugeschickt. Alternativ kann ich den Test bei mir in der Praxis jederzeit durchführen.

Der Test ist interessant für Personen, die ein Infektionsrisiko haben. Das sind also alle diejenigen, die mit einem HIV-positiven Menschen zusammenleben oder ggf. mit Körperflüssigkeiten von Personen in Kontakt kommen können. Dazu gehören natürlich alle, die in einem Krankenhaus arbeiten, aber auch in Sozialeinrichtungen, Justizvollzugsanstalten oder bei der Polizei. Auch das Reinigungspersonal gehört dazu, ebenso wie Lehrer und Kindergärtner, Kranken-und Altenpfleger, sowie Physiotherapeuten. Auch Friseure und Kosmetikerinnen oder Tättowierer tragen ein gewisses Risiko sich ggf. anzustecken. Neben Partnern von HIV positiven Patienten und Drogenabhängigen sind die Prostituierten die am meisten gefährdete Gruppe.

Ein positiver Nachweis der entsprechenden Genmutation kann bei HIV Traegern zu einer Reduktion von antiviralen Medikamenten führen, die sonst i.d.R. für den Rest ihres Lebens von den Patienten eingenommen werden müssten und z.T. zu schweren Nebenwirkungen führen können. Zudem ist der Test zusätzlich zum HIV Tropismustest (also der Bestimmung um welche Virusvariante es sich bei dem jeweiligen Patienten handelt) wichtig, wenn eine Therapie mit dem neuen CCR5 Blocker Maraviroc durchgeführt werden soll. Diese Therapie macht keinen Sinn bei Individuen , die die Mutation homozygot besitzen, da diese den CCR5 Rezeptor gar nicht haben, es somit also auch nichts gibt, was Maraviroc blockieren kann.

Diese Bestimmung sollte niemanden in hundertprozentiger Sicherheit wiegen. Dennoch kann sie ein beruhigender Aspekt für Beziehungen zwischen HIV-positiven und negativen Menschen sein. Dazu gehören nicht nur Partner, sondern auch medizinisches Personal und Angehörige von Gruppen mit höherer HIV-Rate, sowie auch diejenigen, die längere Aufenthalte in Afrika und Ländern mit hoher Durchseuchung planen.

Es muss allerdings betont werden, das HIV positive Individuen auch mit der CCR5 Variante für andere infektiös bleiben, dies jedoch evtl. auf einem niedrigeren Niveau als die CCR5 negative Variante. Dies bleibt jedoch im Moment noch spekulativ und bedarf weiterer Forschung. In jedem Fall muss unabhängig vom Ergebnis die Wichtigkeit von Safer Sex für alle betont werden, denn es besteht immer ein Restrisiko für eine Ansteckung mit HIV und anderen Krankheitserregern. Eine postexpositionelle Therapie sollte ebenso unabhängig vom Genstatus immer bei entsprechender Indikation durchgeführt werden, genauso, wie prä-expositionelle präventive Massnahmen.

Eine der besten zusammenfassenden Arbeiten zu dem Thema CCR5 und der therapeutische Nutzen dieser Endeckung wurde mir von dem bedeutenden Wissenschaftler Prof. Dr. Heiken dankenswerterweise zur Verfügung gestellt. (siehe unten)

Es geht hier um "Langzeitverträglichkeit von CCR5-Inhibitoren"

In den vergangenen Jahren sind erhebliche Fortschritte bei der Behandlung der HIV-1- Infektion erzielt worden. Mit der Einführung der wirksamen antiretroviralen Dreifach- Kombinationstherapie (HAART: hochaktive antiretrovirale Therapie) ist die Morbidität und
Mortalität bei HIV-Patienten seit 1996 stark zurückgegangen (Palella, Jr. et al. 1998). Leider mussten aber auch starke Nebenwirkungen und Langzeit-Toxizitäten beobachtet werden, die bei vielen Patienten zum Wechsel oder gar Abbruch der Therapie führten. Zudem liegen bei vielen Patienten Resistenzen gegen verfügbare antiretrovirale Medikamente vor, die in der
Regel durch suboptimale Virussuppression selektiert oder (sehr viel seltener) bereits bei der Primärinfektion übertragen wurden. Darum ist es dringend notwendig, neue Medikamente zu entwickeln, die gegen resistente HI-Viren noch wirksam und dabei auch langfristig gut verträglich sind. Mit Maraviroc (Celsentri®) wird erstmals ein Rezeptor auf der Wirtszelle
zur antiretroviralen Therapie genutzt, wohingegen alle bisher eingesetzten Medikamente
virale Zielstrukturen hatten. Maraviroc blockiert den Chemokinrezeptor CCR5, der im Jahre
1996 kurz nach der Entdeckung von CXCR4 (Alkhatib et al. 1996) als Korezeptor für T-trope
HIV-1-Isolate von mehreren Arbeitsgruppen als Korezeptor für die Infektion von Zielzellen
mit Makrophagen-tropen HIV-1-Isolaten identifiziert wurde (Übersicht in (Berger et al.
1999). Mit dieser neuen Wirksubstanz und dem neuen Wirkprinzip stellt sich die Frage nach
der Langzeitverträglichkeit, auf die nachfolgend eingegangen werden soll.

Manuskript Heiken, Seite 2
„Natürliche Vorbilder“: Folgen einer fehlenden Expression von CCR5
Interessanterweise wurde im gleichen Jahr der Entdeckung der HIV-Korezeptoren CXCR4
und CCR5 eine natürlich vorkommende genetische Variante von CCR5 beschrieben(CCR5-
delta32), die bei Homozygoten durch fehlende Expression von CCR5 zu einer starken
Resistenz gegenüber einer HIV-1-Infektion führt (Dean et al. 1996; Liu et al. 1996; Huang et
al. 1996). Allerdings wurden einige wenige HIV-1-Infizierte mit einer homozygoten CCR5-
delta32 Mutation beschrieben (Heiken et al. 1999; Sheppard et al. 2002), die vermutlich durch
CXCR4-trope HIV-Stämme infiziert wurden. Somit liegt auch bei Individuen mit einer
homozygoten CCR5-delta 32 Mutation keine vollständige HIV-Resistenz vor. Etwa 1% der
kaukasischen Bevölkerung hat eine homozygote CCR5-delta32 Mutation, die bei anderen
ethnischen Gruppen nur sehr selten vorkommt (Martinson et al. 1997; Novembre et al. 2005).
Menschen mit einer CCR5-delta32 Mutation sind klinisch unauffällig, obwohl CCR5 eine
wichtige Rolle bei Entzündungsprozessen spielt. In speziellen Situationen kann die CCR5-
delta32 Mutation Auswirkungen haben. So führte eine Infektion mit dem West-Nil-Virus im
Mausmodell bei CCR5-defizienten Tieren immer zum Tod, wohingegen normale Mäuse fast
immer überlebten (Glass et al. 2005). Bei der Auswertung von humanen West-Nil-Virus-
Infektionen fand sich bei zwei Kohorten aus Colorado und Arizona ein erhöhter Anteil von
symptomatischen oder tödlichen Verläufen bei Menschen mit einer homozygoten CCR5-
delta32 Mutation (Glass et al. 2006), wobei in der veröffentlichten Studie vermutlich der
Verlauf einer speziellen virulenten West-Nil-Virus Variante beschrieben wurde. Nach einer
Infektion mit Hepatitis B kommt es bei Patienten mit einer homozygoten CCR5-delta32
Mutation häufiger zu einer Ausheilung (Thio et al. 2007), wohingegen die Rolle bei der
Hepatitis C umstritten ist. Aus der Transplantationsmedizin gibt es Hinweise auf einen
besseren Verlauf bei CCR5-delta32 homozygoten Patienten nach Nierentransplantation
(Fischereder et al. 2001), aber nicht nach Herz- (Hummel et al. 2007) oder
Lebertransplantation (Schroppel et al. 2002). Bei Autoimmunerkrankungen wird noch

Manuskript Heiken, Seite 3
kontrovers diskutiert, ob eine homozygote CCR5-delta32 Mutation protektiv gegen die
rheumatoide Arthritis ist (Prahalad 2006; Lindner et al. 2007). Ein Zusammmenhang mit der
Multiplen Sklerose scheint es nicht zu geben. Somit kommt es mit Ausnahme der (fraglich
relevanten) West-Nil-Virus-Infektion bei CCR5-Defizienz nicht zu negativen Konsequenzen
für die betroffenen Menschen.
Die Folgen einer verminderten Expression von CCR5
Bei Vorliegen einer heterozygoten CCR5-delta32 Mutation ist die Oberflächenexpression von
CCR5 reduziert. Diese Reduktion führt nicht zu einer Resistenz gegen HIV-1, weil bei HIV-
1-Infizierten in etwa der gleiche Prozentanteil von Heterozygoten gefunden wird wie in der
gesunden Bevölkerung (in Europa ca. 10 bis 15%). In mehreren Kohortenstudien konnte eine
langsamere Krankeitsprogression bei heterozygoten CCR5-delta32 HIV-1-infizierten
Patienten nachgewiesen werden (Ioannidis et al. 2001). Bei heterozygoten HIV-1-Infizierten
wurde eine stärkere Produktion der natürlichen CCR5-Liganden CCL3 (MIP-1a), CCL4
(MIP-1b) und CCL5 (RANTES) gemessen (Paxton et al. 1998). Diese Chemokine wurden
bereits vor der Entdeckung von CCR5 als Korezeptor als die wichtigsten löslichen HIV-1-
supprimierenden Faktoren beschrieben (Cocchi et al. 1995). Möglicherweise spielt diese
höhere Produktion von HIV-suppressiven Faktoren eine wichtige Rolle bei der verlangsamten
Krankheitsprogression von CCR5-delta32 heterozygoten HIV-1-Patienten. Interessanterweise
fanden epidemiologische Studien eine niedrigere Inzidenz von AIDS-definierenden malignen
Lymphomen bei Individuen mit einer heterozygoten CCR5-delta32 Mutation (Dean et al.
1999; Rabkin et al. 1999). Bislang gibt es keine klaren Belege für negative Auswirkungen
einer verminderten CCR5-Expression, weder in der gesunden Bevölkerung noch bei HIV-1-
Infizierten.

Manuskript Heiken, Seite 4
Pharmakologische Blockade von CCR5
Aus den oben beschriebenen Beispielen wird klar, dass der HIV-1-Korezeptor CCR5 ein
attraktives Ziel für eine pharmakologische Blockade darstellt, weil eine verminderte bzw.
fehlende Funktion von CCR5 mit der fraglichen Ausnahme einer West-Nil-Virus-Infektion
nicht zu negativen Folgen für den betroffenen Menschen führt. Inzwischen wurden 4 oral
verfügbare Substanzen für den therapeutischen Einsatz entwickelt und in klinischen Studien
am Menschen eingesetzt.
Klinische Studien mit Aplaviroc (entwickelt von GlaxoSmithKline) mussten nach zunächst
vielversprechender antiviraler Effektivität (Lalezari et al. 2005) abgebrochen werden,
nachdem es sowohl bei naiven als auch bei vorbehandelten Patienten zu vermehrter
Lebertoxizität gekommen war (Steel 2005). Vicriviroc (Schering Plough) befindet sich
derzeit in klinischer Entwicklung. Erste klinische Studien zeigten gute antivirale Aktivität
nach zweiwöchiger Monotherapie in HIV-1-infizierten Patienten (Schürmann et al. 2007). Die
optimale Dosierung und die Effektivität im Vergleich zur Kontrolltherapie (statt zu Placebo)
sind noch nicht etabliert. Eine Hepatotoxizität wurde im Gegensatz zu Aplaviroc nicht
beobachtet. Auffällig war die hohe Rate von Malignomen bei Vicriviroc-behandelten
Patienten in der ACTG 5211 Studie (Gulick et al. 2007). Von den 90 mit Vicriviroc
behandelten Patienten entwickelten in den 48 Wochen des Beobachtungszeitraumes 8 ein
Malignom: 2 Hodgkin-Lymphome (1 als Rezidiv), 2 Non-Hodgkin-Lymphome (1 als
Rezidiv), 1 Magen-Adenokarzinom, 1 HPV-assoziiertes Plattenepitherkarzinom, 1 Basaliom
und 1 Kaposi-Sarkom (als Rezidiv). Unter den 28 Patienten des Placebo-Arms trat bei 2
Patienten ein Plattenepithelkarzinom auf, ein Patient davon hatte früher bereits 3 Monate lang
Vicriviroc erhalten. Die Heterogenität der beobachteten Malignome und die kleine Zahl der in
der Studie behandelten Patienten lassen derzeit nicht den Schluss zu, dass eine Vicriviroc-
Therapie zu einem erhöhten Auftreten von Malignomen führt. Allerdings wird bei der
weiteren Entwicklung von Vicriviroc die Malignomrate von großem Interesse sein. Für die

Manuskript Heiken, Seite 5
Therapie mit INCB-9471 (Incyte) liegen derzeit Ergebnisse für eine zweiwöchige
Monotherapie bei 10 therapienaiven und 9 vorbehandelten HIV-1-Patienten vor, die auf eine
sehr gute Verträglichkeit und antivirale Potenz schließen lassen (Cohen et al. 2007).
Maraviroc-Studien: Leber und Malignome
Maraviroc (Celsentri®, Pfizer) ist die inzwischen erste zugelassene Substanz zur CCR5-
Blockade. Im Gegensatz zu Aplaviroc, Vicriviroc und INCB-9471 liegen Daten aus großen
Studien mit insgesamt weit über 1300 behandelten Patienten vor (Tabelle 1), aus denen valide
Aussagen zu Nebenwirkungen und Malignominzidenz abgeleitet werden können.
In den Phase 1/2a Studien kam es unter 203 mit unterschiedlichen Maraviroc-Dosierungen
behandelten Patienten nur sehr selten zu Leberwerterhöhungen, und zudem traten diese nur
bei Patienten mit Begleiterkrankungen auf, die Leberwerterhöhungen verursachen können.
Malignome wurden nicht beobachtet.
In der MERIT-Studie erhielten 360 therapienaiven Patienten Combivir + Maraviroc und
wurden mit 361 Patienten verglichen, die Combivir + Efavirenz erhielten. Im Maraviroc-Arm
trat bei einem Patienten ein NHL auf, im Vergleichsarm kam es zu 4 Malignomen (1 NHL, 1
KS, 2 Hodgkin-Lymphome). Die Raten an AST- und ALT-Erhöhungen waren insgesamt
niedrig und in beiden Behandlungsgruppen vergleichbar (Tabelle 2).
In den MOTIVATE 1 & 2-Studien wurden insgesamt 840 Patienten mit Maraviroc
behandelt. Für die mit der jetzt zugelassenen Dosierung von 2 x 300 mg konnten über 420
Patienten ausgewertet werden. Unter den 426 mit Maraviroc behandelten Patienten traten 4
Malignome auf (0,9%), in der Kontrollgruppe kam es bei 5 Patienten (2,4%) zu einer
malignen Erkrankung. In beiden Behandlungsarmen kam es nur selten und mit vergleichbarer
Häufigkeit zu signifikanten Laborwertveränderungen (Tabelle 3).

Manuskript Heiken, Seite 6
In der (A400-) 1029-Studie erhielten 124 Patienten Maraviroc, obwohl ein X4-Virus
nachweisbar war. Es wurde kein Lymphom beobachtet, und die Rate an AST- oder ALTErhöhungen
war niedrig (bei 1 bis 2 Patienten pro Arm, auch im Placebo-Arm).
Zusammenfassung:
Derzeit gibt es keinen Hinweis auf eine klassenspezifische Nebenwirkung der CCR5-
Antagonisten. Aplaviroc wurde aufgrund erhöhter Inzidenz von Hepatotoxizität nicht weiter
entwickelt. Vicriviroc wird in größeren Studien auf die Wirksamkeit im Vergleich zur
etablierten Therapie überprüft, und die Rate an malignen Erkrankungen muss sorgfältig
beobachtet werden. IBCB-9471 befindet sich noch in einer frühen Phase der Entwicklung. Für
die Behandlung mit Maraviroc liegen zwar derzeit noch keine wirklichen Langzeitergebnisse
vor, aber die bisherigen Daten von über 1300 in klinischen Studien behandelten Patienten
belegen neben der guten antiviralen Wirksamkeit auch ein sehr gutes Verträglichkeitsprofil.
Es gibt keine Hinweise auf spezifische Laborwertveränderungen oder auf eine erhöhte
Malignominzidenz. Auch nach der Zulassung wäre es wünschenswert, alle mit Celsentri®
behandelten Patienten sorgfältig zu beobachten und in klinischen Kohortenstudien möglichst
vollständig zu dokumentieren, um gute Daten zur Langzeitverträglichkeit zu generieren.

Manuskript Heiken, Seite 7
Tropismus R5 R5/X4 oder X4
ART-Status naiv vorbehandelt
Studie 1026
MERIT
1027
MOTIVATE 1
1028
MOTIVATE 2
1029
Phase 2b . 3 2b/3 2b/3 2b
Patientenzahl 917 601 474 190
Randomisierung 1:1:1 2:2:1 2:2:1 1:1:1
Design CBV plus
(MVC 1x/d vs.)
MVC 2x/d vs.
EFV
OBT plus
MVC 1x/d vs.
MVC 2x/d vs.
Placebo
OBT plus
MVC 1x/d vs.
MVC 2x/d vs.
Placebo
OBT plus
MVC 1x/d vs.
MVC 2x/d vs.
Placebo
Primärer
Endpunkt
<400/<50 c/ml
nach 44/96 W.
.VL
nach 24/48 W.
.VL
nach 24/48 W.
.VL
nach 24/48 W.
Tabelle 1: Klinische Studien mit Maraviroc

Manuskript Heiken, Seite 8
Alle Ursachen: n, (%) * EFV + CBV MVC + CBV
AST
Grad 3 (>5,0 bis 10,0 x ULN)
Grad 4 (>10,0 x ULN)
9/350 (2,6)
2/350 (0,6)
7/353 (2,0)
5/353 (1,4)
ALT
Grad 3 (>5,0 bis 10,0 x ULN)
Grad 4 (>10,0 x ULN)
9/350 (2,6)
2/350 (0,6)
9/353 (2,5)
2/353 (0,6)
Gesamtbilirubin
Grad 3 (>2,5 bis 5,0 x ULN)
Grad 4 (>5,0 x ULN)
0/345
0/345
3/352 (0,9) †
0/352
Tabelle 2: Anteil der Patienten mit Leberwerterhöhungen in der MERIT-Studie
* nicht korrigiert für Expositionsdauer. ULN = obere Grenze des Normalbereichs,
† 3 Patienten mit Hyperbilirubinämie ohne Transaminaseerhöhung, davon 2 mit Gilbert-
Syndrom.

Manuskript Heiken, Seite 9
Grenzwerte Placebo
+ OBT
(N = 207),
% der Pat.
MVC 2x/d
+ OBT
(N = 421) ,
% der Pat.
Aspartat-Aminotransferase > 5,0 x ULN 2,9 4,5
Alanin-Aminotransferase > 5,0 x ULN 3,4 2,4
Gesamt-Bilirubin > 5,0 x ULN 5,3 5,7
Amylase > 2,0 x ULN 5,8 5,5
Lipase > 2,0 x ULN 6,3 4,9
Absolute Neutrophilenzahl < 750/µl 1,9 3,8
Tabelle 3: Laborwertveränderungen Grad 3 bis 4 in den Studien MOTIVATE 1 und
MOTIVATE 2 (gepoolte Analyse), maximale Veränderungen der Laborwerte (unabhängig
vom Ausgangswert).

Manuskript Heiken, Seite 10
Literaturverzeichnis
(1) Alkhatib G, Combadiere C, Broder CC, Feng Y, Kennedy PE, Murphy PM et al. CC CKR5: a
RANTES, MIP-1alpha, MIP-1beta receptor as a fusion cofactor for macrophage-tropic HIV-1.
Science 1996; 272(5270):1955-1958.
(2) Berger EA, Murphy PM, Farber JM. Chemokine receptors as HIV-1 coreceptors: roles in viral
entry, tropism, and disease. Annu Rev Immunol 1999; 17:657-700.
(3) Cocchi F, DeVico AL, Garzino-Demo A, Arya SK, Gallo RC, Lusso P. Identification of
RANTES, MIP-1 alpha, and MIP-1 beta as the major HIV-suppressive factors produced by
CD8+ T cells. Science 1995; 270(5243):1811-1815.
(4) Cohen C, DeJesus E, Mills A, Pierone G, Kumar P, Ruane P et al. Potent Antiretroviral
Activity of the Once-Daily CCR5 Antagonist INCB009471 Over 14 Days of Monotherapy.
4th IAS Conference on HIV Pathogenesis, Treatment and Prevention Sydney 2007.
(5) Dean M, Carrington M, Winkler C, Huttley GA, Smith MW, Allikmets R et al. Genetic
restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5
structural gene. Science 1996; 273(5283):1856-1862.
(6) Dean M, Jacobson LP, McFarlane G, Margolick JB, Jenkins FJ, Howard OM et al. Reduced
risk of AIDS lymphoma in individuals heterozygous for the CCR5-delta32 mutation. Cancer
Res 1999; 59(15):3561-3564.
(7) Fischereder M, Luckow B, Hocher B, Wuthrich RP, Rothenpieler U, Schneeberger H et al. CC
chemokine receptor 5 and renal-transplant survival. Lancet 2001; 357(9270):1758-1761.
(8) Glass WG, Lim JK, Cholera R, Pletnev AG, Gao JL, Murphy PM. Chemokine receptor CCR5
promotes leukocyte trafficking to the brain and survival in West Nile virus infection. J Exp
Med 2005; 202(8):1087-1098.
(9) Glass WG, McDermott DH, Lim JK, Lekhong S, Yu SF, Frank WA et al. CCR5 deficiency
increases risk of symptomatic West Nile virus infection. J Exp Med 2006; 203(1):35-40.
(10) Gulick RM, Su Z, Flexner C, Hughes MD, Skolnik PR, Wilkin TJ et al. Phase 2 study of the
safety and efficacy of vicriviroc, a CCR5 inhibitor, in HIV-1-Infected, treatment-experienced
patients: AIDS clinical trials group 5211. J Infect Dis 2007; 196(2):304-312.
(11) Heiken H, Becker S, Bastisch I, Schmidt RE. HIV-1 infection in a heterosexual man
homozygous for CCR-5 delta32. AIDS 1999; 13(4):529-530.
(12) Huang Y, Paxton WA, Wolinsky SM, Neumann AU, Zhang L, He T et al. The role of a
mutant CCR5 allele in HIV-1 transmission and disease progression. Nat Med 1996;
2(11):1240-1243.
(13) Hummel M, Bara C, Hirt S, Haverich A, Hetzer R. Prevalence of CCR5Delta32
polymorphism in long-term survivors of heart transplantation. Transpl Immunol 2007;
17(3):223-226.
(14) Ioannidis JP, Rosenberg PS, Goedert JJ, Ashton LJ, Benfield TL, Buchbinder SP et al. Effects
of CCR5-Delta32, CCR2-64I, and SDF-1 3'A alleles on HIV-1 disease progression: An
international meta-analysis of individual-patient data. Ann Intern Med 2001; 135(9):782-795.

Manuskript Heiken, Seite 11
(15) Lalezari J, Thompson M, Kumar P, Piliero P, Davey R, Patterson K et al. Antiviral activity
and safety of 873140, a novel CCR5 antagonist, during short-term monotherapy in HIVinfected
adults. AIDS 2005; 19(14):1443-1448.
(16) Lindner E, Nordang GB, Melum E, Flato B, Selvaag AM, Thorsby E et al. Lack of association
between the chemokine receptor 5 polymorphism CCR5delta32 in rheumatoid arthritis and
juvenile idiopathic arthritis. BMC Med Genet 2007; 8:33.
(17) Liu R, Paxton WA, Choe S, Ceradini D, Martin SR, Horuk R et al. Homozygous defect in
HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1
infection. Cell 1996; 86(3):367-377.
(18) Martinson JJ, Chapman NH, Rees DC, Liu YT, Clegg JB. Global distribution of the CCR5
gene 32-basepair deletion. Nat Genet 1997; 16(1):100-103.
(19) Novembre J, Galvani AP, Slatkin M. The geographic spread of the CCR5 Delta32 HIVresistance
allele. PLoS Biol 2005; 3(11):e339.
(20) Palella FJ, Jr., Delaney KM, Moorman AC, Loveless MO, Fuhrer J, Satten GA et al.
Declining morbidity and mortality among patients with advanced human immunodeficiency
virus infection. HIV Outpatient Study Investigators. N Engl J Med 1998; 338(13):853-860.
(21) Paxton WA, Kang S, Koup RA. The HIV type 1 coreceptor CCR5 and its role in viral
transmission and disease progression. AIDS Res Hum Retroviruses 1998; 14 Suppl 1:S89-92.
(22) Prahalad S. Negative association between the chemokine receptor CCR5-Delta32
polymorphism and rheumatoid arthritis: a meta-analysis. Genes Immun 2006; 7(3):264-268.
(23) Rabkin CS, Yang Q, Goedert JJ, Nguyen G, Mitsuya H, Sei S. Chemokine and chemokine
receptor gene variants and risk of non-Hodgkin's lymphoma in human immunodeficiency
virus-1-infected individuals. Blood 1999; 93(6):1838-1842.
(24) Schroppel B, Fischereder M, Ashkar R, Lin M, Kramer BK, Mardera B et al. The impact of
polymorphisms in chemokine and chemokine receptors on outcomes in liver transplantation.
Am J Transplant 2002; 2(7):640-645.
(25) Schürmann D, Fätkenheuer G, Reynes J, Michelet C, Raffi F, van Lier J et al. Antiviral
activity, pharmacokinetics and safety of vicriviroc, an oral CCR5 antagonist, during 14-day
monotherapy in HIV-infected adults. AIDS 2007; 21(10):1293-1299.
(26) Sheppard HW, Celum C, Michael NL, O'Brien S, Dean M, Carrington M et al. HIV-1
infection in individuals with the CCR5-Delta32/Delta32 genotype: acquisition of syncytiuminducing
virus at seroconversion. J Acquir Immune Defic Syndr 2002; 29(3):307-313.
(27) Steel HM. Special presentation on aplaviroc-related hepatotoxicity. 10th EACS, Dublin 2005.
(28) Thio CL, Astemborski J, Bashirova A, Mosbruger T, Greer S, Witt MD et al. Genetic
protection against hepatitis B virus conferred by CCR5Delta32: Evidence that CCR5
contributes to viral persistence. J Virol 2007; 81(2):441-445.

Not an HIV Cure, but Encouraging New Directions

Jay A. Levy, M.D.

N Engl J Med 2009; 360:724-725February 12, 2009

<dl class="articleTabs tabPanel lastChild" sizset="14" sizcache="51" jquery1291064278668="40"><dt class="active article firstChild sideBySide" id="articleTab" jquery1291064278668="3">Article</dt><dt class="references sideBySide inactive" id="referencesTab" jquery1291064278668="4">References</dt><dd id="article" style="DISPLAY: block" sizset="14" sizcache="51" jquery1291064278668="6">

The history of infectious diseases frequently includes people who were resistant to a pathogen. Such a phenomenon helped the Spanish, who had resistance to smallpox, in their conquest of South America, but not the Aztecs or the Incas, who had no resistance to smallpox and were decimated by the virus.1 Microbial resistance involves adaptive (acquired) immunity (e.g., the HLA subtype) or innate (natural) immunity resulting from the genetic makeup of the host.2

With the human immunodeficiency virus (HIV) and its known destruction of the immune system, resistance to infection and disease was not initially expected. However, certain people — long-term survivors — have been infected with HIV for more than 10 years (and sometimes 30 years) and received no treatment yet remain without disease.2 In addition, some people who have been exposed to HIV on many occasions do not become infected.3 Both long-term survivors and those who have been exposed to HIV but remain seronegative offer a great opportunity to study the mechanisms of resistance to HIV infection and disease.

HIV enters cells primarily through attachment to the CD4 molecule and subsequent binding to coreceptors, of which two chemokine receptors, CCR5 and CXCR4, are the most common. R5 HIV types bind to CCR5; X4 HIV types use CXCR4.4 People whose cells lack expression of the CCR5 gene are markedly resistant to HIV infection despite multiple exposures to R5 HIV, which is the most prominent virus detected after transmission.2,4 This mutation is found in 1 to 3% of the Western population. Among people with HIV who have only one copy of the wild-type CCR5 gene, progression to disease appears to be slower than among those who have two.4,5 Obviously, such information is of value in efforts to develop new approaches for therapy.

In 2007, an estimated 2 million people died from AIDS and 2.7 million contracted the virus. Currently, infected patients can benefit from antiretroviral therapies that effectively delay or prevent progression to AIDS.6 These people are in many cases healthy but continue to carry HIV. If the antiretroviral therapy is stopped, however, a rebound in virus production occurs that can lead to AIDS.7 Moreover, the virus can develop resistance to antiretroviral therapy and reemerge in the host. Long-term treatment with these drugs is also costly and can cause toxicities that are often life-threatening, including disorders of the cardiovascular system, pancreas, kidney, and liver.8 And only a fraction of the people who are infected and need antiretroviral therapy are receiving therapy, particularly in countries with limited resources.

For these reasons, a search for better, long-term treatment for HIV infection continues. In this issue of the Journal, Hütter et al. highlight an innovative approach that could prove beneficial for the long-term control of HIV without antiretroviral therapy.9 These investigators selected an HLA-compatible person whose cells lacked expression of CCR5 as the donor for stem-cell transplantation from bone marrow to a patient with acute myelogenous leukemia who was infected with HIV. After two transplantations, there has been no recurrence of leukemia or detectible HIV in the bloodstream, as determined by analyses of viral RNA and cellular proviral DNA. In addition, after nearly 2 years, the CD4+ T cells in this patient have returned to a normal range, all carrying the donor's homozygote-deleted CCR5 gene.

Although some observers may consider the patient cured of HIV, this conclusion is premature. Much evidence has shown that HIV can be lurking in cells found in the lymph nodes and other parts of the body, including the brain, gut, liver, kidneys, and heart.2 Eventually, the virus could induce disease in these tissues. Nevertheless, the results of this study and others10 provide further encouragement for those examining approaches to treatment that reduce CCR5 expression in persons with HIV infection.

Bone marrow transplantations requiring ablation of host immune cells, as in this case, are risky; many patients die from the procedure. Autologous stem-cell administration after manipulation to eliminate CCR510 carries a similar risk. Consequently, an approach designed to modify HIV target cells without eliminating the host's own bone marrow could be helpful. An example would be to inject into the patient with HIV a CCR5-inactivating biochemical compound or genetic vector that would enter white cells and eventually make them resistant to HIV. A compound that could enter the stem cells of the patient would be the most effective for long-lasting protection. Development of such technologies could include injecting into the bloodstream vectors carrying small interfering RNA (siRNA), antisense RNA, or ribozymes, all of which reduce CCR5 cellular expression.10,11 Another approach could involve small, injectable, arginine-rich particles containing RNA that down-regulates CCR5 expression by interrupting normal gene splicing.12 Although such techniques need to be perfected, they point in directions that may serve as stimuli for other innovative gene therapies to help those infected with HIV.

Certain issues, however, need to be appreciated. An X4 type of HIV that was detected at low levels in the blood of the patient studied by Hütter et al. could eventually emerge. This virus grows in cells lacking CCR5 expression.2-4 Moreover, after transplantation, the patient's remaining CCR5-expressing macrophages — major cells for R5 virus infection — had no evidence of HIV. What protected these cells? Perhaps the CCR5 protein was present at low density on these cells, since the patient was heterozygous for the mutated allele. Or, since HIV-specific T cells were not prominent, innate immune responses could be suppressing both the R5 and X4 viruses.13 One caveat is that people lacking the CCR5 gene can be more susceptible to serious effects from certain infections, such as West Nile virus.14

Therapeutic targeting of CCR5 could delay the onset of disease and reduce the cost and toxicity of antiretroviral therapy, as it has in this patient for nearly 2 years. This case places further emphasis on gene therapies and treatments directed at blocking the CCR5 receptor with decoy drugs. Maraviroc, a recently approved CCR5 inhibitor, has had some success,15 but it must be administered along with other antiretroviral medications. It is probable that HIV resistance to maraviroc occurs because the CCR5 molecule remains expressed on cells. In summary, the case reported by Hütter et al.9 could pave the way for innovative approaches that provide long-lasting viral control with limited toxicities for persons with HIV infection.

No potential conflict of interest relevant to this article was reported.

Source Information

From the University of California, San Francisco, San Francisco.

</dd></dl>

Original Article

Brief Report

Long-Term Control of HIV by CCR5 Delta32/Delta32 Stem-Cell Transplantation

Gero Hütter, M.D., Daniel Nowak, M.D., Maximilian Mossner, B.S., Susanne Ganepola, M.D., Arne Müßig, M.D., Kristina Allers, Ph.D., Thomas Schneider, M.D., Ph.D., Jörg Hofmann, Ph.D., Claudia Kücherer, M.D., Olga Blau, M.D., Igor W. Blau, M.D., Wolf K. Hofmann, M.D., and Eckhard Thiel, M.D.

N Engl J Med 2009; 360:692-698February 12, 2009

<dl class="articleTabs tabPanel lastChild" sizset="14" sizcache="51" jquery1291064428056="97"><dt class="active abstract firstChild sideBySide inactive" id="abstractTab" jquery1291064428056="57">Abstract</dt><dt class="article sideBySide" id="articleTab" jquery1291064428056="58">Article</dt><dt class="references sideBySide inactive" id="referencesTab" jquery1291064428056="59">References</dt><dt class="citedby sideBySide inactive" id="citedbyTab" jquery1291064428056="60">Citing Articles (31) </dt><dd id="abstract" style="DISPLAY: none" sizset="14" sizcache="51" jquery1291064428056="62">

Infection with the human immunodeficiency virus type 1 (HIV-1) requires the presence of a CD4 receptor and a chemokine receptor, principally chemokine receptor 5 (CCR5). Homozygosity for a 32-bp deletion in the CCR5 allele provides resistance against HIV-1 acquisition. We transplanted stem cells from a donor who was homozygous for CCR5 delta32 in a patient with acute myeloid leukemia and HIV-1 infection. The patient remained without viral rebound 20 months after transplantation and discontinuation of antiretroviral therapy. This outcome demonstrates the critical role CCR5 plays in maintaining HIV-1 infection.

Full Text of ...

Read the Full Article...

Source Information

From the Department of Hematology, Oncology, and Transfusion Medicine (G.H., D.N., M.M., S.G., A.M., O.B., I.W.B., W.K.H., E.T.) and the Department of Gastroenterology, Infectious Diseases, and Rheumatology (K.A., T.S.), Campus Benjamin Franklin; and the Institute of Medical Virology, Campus Mitte (J.H.) — all at Charité Universitätsmedizin Berlin; and the Robert Koch Institute (C.K.) — all in Berlin.

Address reprint requests to Dr. Hütter at Medical Department III Hematology, Oncology, and Transfusion Medicine, Charité Campus Benjamin Franklin, Hindenburgdamm 30 D-12203 Berlin, Germany, or at gero.huetter(at)charite.de.

Media in This Article

Figure 1Genotyping of CCR5 Alleles.Figure 2Cellular and Humoral Immune Response to HIV-1.Figure 3Clinical Course and HIV-1 Viremia.Figure 4Expression of CD Surface Antigen and Chemokine Coreceptor in the Patient's Rectal Mucosa.

Article Activity

31 articles have cited this article

</dd><dd id="article" style="DISPLAY: block" sizset="22" sizcache="51" jquery1291064428056="63">

HIV-1 enters host cells by binding to a CD4 receptor and then interacting with either CCR5 or the CXC chemokine receptor (CXCR4). Homozygosity for a 32-bp deletion (delta32/delta32) in the CCR5 allele results in an inactive CCR5 gene product and consequently confers high resistance against HIV-1 acquisition.1

Allogeneic stem-cell transplantation from an HLA-matched donor is a feasible option for patients with hematologic neoplasms, but it has not been established as a therapeutic option for patients who are also infected with HIV.2 Survival of patients with HIV infection has improved considerably since the introduction of highly active antiretroviral therapy (HAART),3 and as a consequence, successful allogeneic stem-cell transplantation with ongoing HAART was performed in 2000.4

In this report, we describe the outcome of allogeneic stem-cell transplantation in a patient with HIV infection and acute myeloid leukemia, using a transplant from an HLA-matched, unrelated donor who was screened for homozygosity for the CCR5 delta32 deletion.

Case Report

A 40-year-old white man with newly diagnosed acute myeloid leukemia (FAB M4 subtype, with normal cytogenetic features) presented to our hospital. HIV-1 infection had been diagnosed more than 10 years earlier, and the patient had been treated with HAART (600 mg of efavirenz, 200 mg of emtricitabine, and 300 mg of tenofovir per day) for the previous 4 years, during which no illnesses associated with the acquired immunodeficiency syndrome (AIDS) were observed. At the time that acute myeloid leukemia was diagnosed, the patient's CD4 T-cell count was 415 per cubic millimeter, and HIV-1 RNA was not detectable (stage A2 according to classification by the Centers for Disease Control and Prevention). Initial treatment of the acute myeloid leukemia consisted of two courses of induction chemotherapy and one course of consolidation chemotherapy. During the first induction course, severe hepatic toxic effects developed and renal failure occurred. Consequently, HAART was discontinued, leading to a viral rebound (6.9×10⁶ copies of HIV-1 RNA per milliliter). The therapy was resumed immediately, before a viral steady state was reached, and 3 months later, HIV-1 RNA was undetectable.

Seven months after presentation, acute myeloid leukemia relapsed, and the patient underwent allogeneic stem-cell transplantation with CD34+ peripheral-blood stem cells from an HLA-identical donor who had been screened for homozygosity for the CCR5 delta32 allele. The patient provided informed consent for this procedure, and the protocol was approved by the institutional review board. The HLA genotypes of the patient and the donor were identical at the following loci: A*0201; B*0702,3501; Cw*0401,0702; DRB1*0101,1501; and DQB1*0501,0602. The patient underwent a conditioning regimen and received a graft containing 2.3×10⁶ CD34+ cells per kilogram of body weight.5 Prophylaxis against graft-versus-host disease consisted of 0.5 mg of rabbit antithymocyte globulin per kilogram 3 days before transplantation, 2.5 mg per kilogram 2 days before, and 2.5 mg per kilogram 1 day before. The patient received two doses of 2.5 mg of cyclosporine per kilogram intravenously 1 day before the procedure and treatment with mycophenolate mofetil at a dose of 1 g three times per day was started 6 hours after transplantation. HAART was administered until the day before the procedure, and engraftment was achieved 13 days after the procedure. Except for the presence of grade I graft-versus-host disease of the skin, which was treated by adjusting the dosage of cyclosporine, there were no serious infections or toxic effects other than grade I during the first year of follow-up. Acute myeloid leukemia relapsed 332 days after transplantation, and chimerism transiently decreased to 15%. The patient underwent reinduction therapy with cytarabine and gemtuzumab and on day 391 received a second transplant, consisting of 2.1×10⁶ CD34+ cells per kilogram, from the same donor, after treatment with a single dose of whole-body irradiation (200 cGy). The second procedure led to a complete remission of the acute myeloid leukemia, which was still in remission at month 20 of follow-up.

Methods

CCR5 Genotyping

Genomic DNA was extracted from heparinized peripheral-blood monocytes obtained from the patient and the prospective donor, with the use of the QIAamp Blood Midi Kit (Qiagen). Screening of donors for the CCR5 delta32 allele was performed with a genomic polymerase-chain-reaction (PCR) assay, with primers flanking the site of the deletion (forward, 5′CTCCCAGGAATCATCTTTACC3′; reverse, 5′TCATTTCGACACCGAAGCAG3′), resulting in a PCR fragment of 200 bp for the CCR5 allele and 168 bp for a delta32 deletion. Results were confirmed by allele-specific PCR and by direct sequencing with the use of the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). Sequences were analyzed with the use of Vector NTI ContigExpress software (Invitrogen).

Viral-Envelope Genotyping

Coreceptor use by HIV-1 was assessed through V3 amino acid sequences of the env region for both DNA and RNA. Bulk PCR products were subjected to direct sequencing and determined according to the 11/25 and net charge rules, as described by Delobel et al.6

For RNA, the HIV env region was sequenced from position 6538 to 6816 and Web position-specific scoring matrix (WebPSSM), and geno2pheno bioinformatic software was used to predict viral coreceptor use. In addition, an ultradeep PCR analysis with parallel sequencing (454-Life-Sciences, Roche) was performed.7

Chemokine Receptors and Surface Antigens

Mucosal cells were isolated from 10 rectal-biopsy specimens according to the method of Moos et al.8 CCR5 expression was stimulated by phytohemagglutinin (Sigma), and the cells were analyzed by means of flow cytometry with the use of antibodies against CD3, CD4, CD11c, CD163, and CCR5 (BD Biosciences).

Chimerism

Standard chimerism analyses were based on the discrimination between donor and recipient alleles on short tandem repeats, with the use of PCR and fluorescence-labeled primers according to the method of Blau et al.9

Cellular and Humoral Immune Responses

Secretion of interferon-γ by antigen-specific cells was induced according to the method of Ganepola et al.10 For measurement of T-cell–mediated immune responses, two HLA-A*0201–binding peptides were used: HIV-1_476–484 (ILKEPVHGV) and cytomegalovirus (CMV)_65–73 (NLVPMVATV). The presence of antibodies against HIV-1 and HIV type 2 (HIV-2) was determined by means of an enzyme-linked immunoassay and immunoblot assays in accordance with the procedures recommended by the manufacturers (Abbott and Immogenetics).

Amplification of HIV-1 RNA and DNA

HIV-1 RNA was isolated from plasma and amplified with the use of the Cobas AmpliPrep–TaqMan HIV assay system (Roche). Total DNA was isolated from peripheral-blood monocytes and rectal-biopsy specimens with the use of the QIAamp DNA Blood Mini Kit and the AllPrep DNA/RNA Mini Kit, respectively (both from Qiagen). The env and long-terminal-repeat regions were amplified according to the method of Cassol et al. and Drosten et al.11,12 The sensitivity of the RNA assay was 40 copies per milliliter, and the lower limit of detection for both complementary DNA (cDNA) PCR assays is 5 copies per reaction, with a positivity rate of more than 95%. Each assay contained 2×10⁴ to 5×10⁴ CD4+ T cells. The successful amplification of 1 μg of cellular DNA extracted from various housekeeping genes (GAPDH, CCR5, and CD4) extracted from 1 μg cellular DNA indicated the suitability of the DNA isolated from the mucosal specimens.

Results

Distribution of CCR5 Alleles

Genomic DNA from 62 of 80 potential HLA-identical stem-cell donors registered at the German Bone Marrow Donor Center was sequenced in the CCR5 region. The frequencies of the delta32 allele and the wild-type allele were 0.21 and 0.79, respectively. Only one donor was homozygous for the CCR5 delta32 deletion in this cohort.

Analysis of HIV-1 Coreceptor Phenotype

Sequence analysis of the patient's viral variants revealed a glycine at position 11 and a glutamic acid at position 25 of the V3 region. The net charge of amino acids was +3. These results indicated CCR5 coreceptor use by the HIV-1 strain infecting the patient, a finding that was confirmed by sequencing RNA in the HIV env region. The ultradeep sequencing analysis revealed a proportion of 2.9% for the X4 and dual-tropic variants combined.

Recipient Chimerism

With ongoing engraftment, the PCR patterns of CCR5 were transformed, indicating a shift from a heterozygous genotype to a homozygous delta32/delta32 genotype (Figure 1Figure 1Genotyping of CCR5 Alleles.). Complete chimerism, determined on the basis of allelic short tandem repeats, was obtained 61 days after allogeneic stem-cell transplantation.

Cellular and Humoral Immune Responses

T-cell responses to defined HLA-A2–restricted antigens, determined with the use of an interferon-γ enzyme-linked immunospot assay, revealed elevated frequencies of HIV-specific T cells before stem-cell transplantation and undetectable frequencies after transplantation (Figure 2AFigure 2Cellular and Humoral Immune Response to HIV-1.). Immunoblot analysis revealed a predominant loss of antibodies to polymerase and capsid proteins after transplantation, whereas levels of antibodies to soluble glycoprotein 120 and glycoprotein 41 remained detectable (Figure 2B).

Quantification of Viremia

The HIV-1 load was measured with the use of RNA and DNA PCR assays (Figure 3Figure 3Clinical Course and HIV-1 Viremia.). Throughout the follow-up period, serum levels of HIV-1 RNA remained undetectable. Also during follow-up, the semiquantitative assay showed no detectable proviral DNA except on the 20th day after transplantation, for both the env and long-terminal-repeat loci, and on the 61st day after transplantation, for the env locus.

Rectal-Biopsy Specimens

In rectal-biopsy specimens obtained 159 days after transplantation, macrophages showed expression of CCR5, whereas a distinct CCR5-expressing population was not present in the mucosal CD4+ T lymphocytes (Figure 4Figure 4Expression of CD Surface Antigen and Chemokine Coreceptor in the Patient's Rectal Mucosa.).

Discussion

To enter target cells, HIV-1 requires both CD4 and a coreceptor, predominantly CCR5. Blocking of the preferentially used CCR5 receptor by inhibitors or through gene knockdown conferred antiviral protection to R5-tropic variants.13,14 The homozygous CCR5 delta32 deletion, observed in approximately 1% of the white population, offers a natural resistance to HIV acquisition. We report a successful transplantation of allogeneic stem cells homozygous for the CCR5 delta32 allele to a patient with HIV.

Although discontinuation of antiretroviral therapy typically leads to a rapid rebound of HIV load within weeks, in this patient, no active, replicating HIV could be detected 20 months after HAART had been discontinued.15 This observation is remarkable because homozygosity for CCR5 delta32 is associated with high but not complete resistance to HIV-1. This outcome can be explained by the behavior of non-CCR5-tropic variants, such as CXCR4-tropic viruses (X4), which are able to use CXCR4 as a coreceptor. The switch occurs in the natural course of infection, and the proportion of X4 increases with ongoing HAART.16 Genotypic and phenotypic assays can be used to determine the nature and extent of coreceptor use, but the presence of heterogeneous viral populations in samples from patients limits the sensitivity of the assay.17 When genotypic analysis was performed in two laboratories applying WebPSSM and geno2pheno prediction algorithms, X4 variants were not detected in the plasma of our patient. To determine the proportion of minor variants in the plasma, we performed an ultradeep sequencing analysis, which revealed a small proportion of X4 variants before the allogeneic stem-cell transplantation.

Even after prolonged HAART, the persistence of HIV-1 populations in various anatomical compartments can be observed in patients without detectable viremia.18 In particular, the intestinal lamina propria represents an important reservoir of HIV-1, and genomic virus detection is possible in patients without viremia.19 In this patient, a rectal biopsy performed 159 days after transplantation revealed that CCR5-expressing macrophages were still present in the intestinal mucosa, indicating that they had not yet been replaced by the new immune system. Although these long-lasting cells from the host can represent viral reservoirs even after transplantation, HIV-1 DNA could not be detected in this patient's rectal mucosa.

It is likely that X4 variants remained in other anatomical reservoirs as potential sources for reemerging viruses, but the number of X4-tropic infectious particles after transplantation could have been too low to allow reseeding of the patient's replaced immune system.

The loss of anti-HIV, virus-specific, interferon-γ–producing T-cells during follow-up suggests that HIV antigen stimulation was not present after transplantation. This disappearance of effector T cells was not associated with a deficient immune reconstitution, as shown by the absence of relevant infection or reactivation of other persistent viruses, such as CMV and Epstein–Barr virus. Thus, the absence of measurable HIV viremia in our patient probably represents the removal of the HIV immunologic stimulus.20 Antibodies against HIV-envelope antigens have remained detectable, but at continually decreasing levels. The sustained secretion of antibodies might be caused by long-lived plasma cells that are relatively resistant to common immunosuppressive therapies.21,22

In the past, there were several attempts to control HIV-1 infection by means of allogeneic stem-cell transplantation without regard to the donor's CCR5 delta32 status, but these efforts were not successful.23 In our patient, transplantation led to complete chimerism, and the patient's peripheral-blood monocytes changed from a heterozygous to a homozygous genotype regarding the CCR5 delta32 allele. Although the patient had non–CCR5-tropic X4 variants and HAART was discontinued for more than 20 months, HIV-1 virus could not be detected in peripheral blood, bone marrow, or rectal mucosa, as assessed with RNA and proviral DNA PCR assays. For as long as the viral load continues to be undetectable, this patient will not require antiretroviral therapy. Our findings underscore the central role of the CCR5 receptor during HIV-1 infection and disease progression and should encourage further investigation of the development of CCR5-targeted treatment options.

Drs. Hofmann and Thiel contributed equally to this article.

Supported by a grant from the German Research Foundation (DFG KFO grant 104 1/1).

Dr. Hofmann reports serving as a consultant or advisory-board member and on speakers' bureaus for Celgene and Novartis. No other potential conflict of interest relevant to this article was reported.

Source Information

We thank Alexander Schmidt, Petra Leuker, and Gerhard Ehninger (German Bone Marrow Center, Tübingen and Dresden, Germany) for their encouragement and cooperation regarding access of donor blood samples; Emil Morsch (Stefan Morsch Foundation, Birkenfeld, Germany) and Martin Meixner (Department of Biochemistry, Charité Universitätsmedizin, Berlin) for performing sequencing; Stephan Fuhrmann and Mathias Streitz (Department of Immunology, Charité Universitätsmedizin, Berlin) for providing HIV p24 antigens; Alexander Thielen (Max-Planck-Institut für Informatik, Saarbrücken, Germany) for performing 454 ultradeep-sequencing data analysis; Lutz Uharek (Department of Hematology, Charité Universitätsmedizin) for clinical supervision of the allogeneic stem-cell transplantation; and Martin Raftery (Institute of Medical Virology, Charité Universitätsmedizin, Berlin) for reading an earlier version of this article.

</dd></dl>